Foro Flamenco


Posts Since Last Visit | Advanced Search | Home | Register | Login

Today's Posts | Inbox | Profile | Our Rules | Contact Admin | Log Out



Welcome to one of the most active flamenco sites on the Internet. Guests can read most posts but if you want to participate click here to register.

This site is dedicated to the memory of Paco de Lucía, Ron Mitchell, Guy Williams, Linda Elvira, Philip John Lee, Craig Eros, Ben Woods, David Serva and Tom Blackshear who went ahead of us.

We receive 12,200 visitors a month from 200 countries and 1.7 million page impressions a year. To advertise on this site please contact us.





Major major frustration   You are logged in as Guest
Users viewing this topic: none
  Printable Version
All Forums >>Discussions >>General >> Page: [1] 2    >   >>
Login
Message<< Newer Topic  Older Topic >>
 
John O.

Posts: 1723
Joined: Dec. 16 2005
From: Seeheim-Jugenheim, Germany

Major major frustration 

Hey guys. Gotta vent here.

I suck at flamenco. I mean, really.

Ask me to play "Reflejo de Luna", "Con Garbo y Salero", "a really cool intro I heard once from Vicente", no problem.

Sit me in a class and ask me to accompany, all you'll get is chord strumming. Lots of syncopation, mind you, yet still the most uninspirational crap you'll ever hear. Ask me to play a falsetta, "Duuuh, I dunno", more chords.

A lot of it could be nervousness, somehow I just can't put the technique I have together with the dance accompanyment, though I've been accompanying quite intensly for about two years now.

Should I just give up?????
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 5 2006 6:26:29
 
Doitsujin

Posts: 5078
Joined: Apr. 10 2005
 

RE: Major major frustration (in reply to John O.

NO! Only 2 years? Thats nothing.. A singer told me in past.. The first 10 years are very difficult in flamenco.. the 20 after them are a bit more easy..^^

My skills usually dont get better poco a poco. I play allways for a long time on the same level. Than from one day to the next, I get much better. Than the same for a long time.. It took month and years..It could be that you are close to the next step. So dont stop now!

And Im not very reative, too. But when I sit down and work hard and play much stupid ideas. I can construct nice falsetas. Its just damn hard for me. Maybe you have not enough time to play for yourself. You said you work the whole day and after that 3hours playing for dance.
If you have a nice dancingteacher, you can construct flseatas in the dancingclass. For me it works best there.
If you are complete uncreative, take some falsetas wich you already can play. Than change them and play them in a different palo than the original. For example take a bulerias falseta and put it n tangos. You will get new falsetas AND many ideas for new stuff.
A second good way to get ideas is to compose with music in your ear. It must not be flamenco. Just the music you like. Play with it, and you will get some ideas.

If you compose for Solea por bulerias or alegrias.. play a record with compas while composing. For me it works best if the compas alsone is still grooving. So take a good one.
Come on...!! You have around a year,..than I need some good compositions of you for our CD.
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 5 2006 8:43:33
 
John O.

Posts: 1723
Joined: Dec. 16 2005
From: Seeheim-Jugenheim, Germany

RE: Major major frustration (in reply to Doitsujin

You still owe me a tiento falsetta which sounds good at 60 beats per minute, that would be a great help, too...

Thanks for the advice!

Another thing I still don't get, the whole "learning by heart" thing being so horrible. If I have a choreography I'm playing to, eventually I'm just gonna know what happens when, right? Like in our polo when the dancers step forward it's time for escobilla, when they take a step back on 12, it's over. In our tiento the llamada leading to tango is three tacts. I know all that by heart, is that so bad? Maybe I'm missing something or making it more complicated than it is, I just don't get where you draw the line...
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 5 2006 8:56:13
 
Doitsujin

Posts: 5078
Joined: Apr. 10 2005
 

RE: Major major frustration (in reply to John O.

Ok I will try to put two falsetas in Gp4 today and tomorrow. Do you know the enrique de melchor encuentro? He played a great tiento falseta. Its good for dance. Mine is a bit free..its better for an entrada.

To the dance acompaniment. How is the spelling of that hard word??
Its good that you know it by heart. You should not count the compas or the beats. If you dont feel it or see it, you wont be able to help the dancers out of mistakes they sometimes do on stage. And the second reason why you should ONLY feel the structure is,..you can give it more liing in your playing. If you allways have to count, you cant improvise good. So, I think you do it exactly right.
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 5 2006 10:09:48
 
Miguel de Maria

Posts: 3532
Joined: Oct. 20 2003
From: Phoenix, AZ

RE: Major major frustration (in reply to John O.

John,
don't worry, you're doing fine. These things just take time. You already have excellent technical skills and good compas. Doit gave good advice. Another thing you can do is just change major falsetas to minor. You can get a lot of great ideas just by watching the dancers and copying whatever rhythm they choose to emphasize. Maybe the falsetas you know are not suited for dance accomp. Why don't you get that Sabicas Carmen Amaya CD, I bet you could find plenty of material to copy there.

_____________________________

Connect with me on Facebook, all the cool kids are doing it.
https://www.facebook.com/migueldemariaZ


Arizona Wedding Music Guitar
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 5 2006 13:28:42

JBASHORUN

Posts: 1839
Joined: Jan. 23 2005
 

RE: Major major frustration (in reply to John O.

quote:

Should I just give up?????


Patience, Juan. Don't give up. I've been playing Flamenco almost 2 years now and I have to admit that I am awful at it. I can just about play 2 short Soleas, a Fandangos De Huelva and a basic folk song. Tremolo is a no-no, and my picado sucks big time. The only thing I'm okay at is pulgar work, which is because I'm used to using my thumb for playing virtually everything (even picado!). Accompanying singers or dancers is completely out of the question at my level. I think you're probably doing okay considering you've only been learning Flamenco a short while, and you're undoubtedly much better than I am. I'm sure if you work hard for a few more years you'll gradually be less and less frustrated.


Jb
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 5 2006 13:37:34

ivan

 

Posts: 73
Joined: Oct. 6 2005
 

RE: Major major frustration (in reply to John O.

2 years? don't worry too much. you guys know that flamenco is one of the most difficult art forms. Accompaniment is also another major hurdle. It takes years of working w/ dancers to get it just right. Con tiempo tio,
Ivan
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 1:42:10
 
cneberg

Posts: 257
Joined: Apr. 20 2006
From: Sončno polje pri Večnosti

RE: Major major frustration (in reply to John O.

Don't be such a cry baby...
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 12:13:46
 
John O.

 

Posts: 1723
Joined: Dec. 16 2005
 

[Deleted] 

Post has been moved to the Recycle Bin at Jul. 6 2006 12:44:12
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 12:19:11
 
koella

Posts: 2194
Joined: Sep. 10 2005
From: holland

RE: Major major frustration (in reply to John O.

Btw. I saw this video about a gitano family that was preparing an international show.
The dancers were trying to make a choreography on the falseta's. Not the other way around. While rehearsing there were some changes in the llamada's and accentuation of the rasgueado's but nothing more. The music seemed fixed already.

So be friends with a dance teacher, invite her at home( or him..sorry )

And get to work !


Or am I talking crap here ?
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 12:41:14
 
John O.

Posts: 1723
Joined: Dec. 16 2005
From: Seeheim-Jugenheim, Germany

RE: Major major frustration (in reply to cneberg

Sorry, almost turned into a b*tchy baby there

I'm usually pretty confident about what I do, I just had a bad day when I made this thread and wanted to reassure myself that I'm not that guy in denial behind who's back everybody says "Geez, why doesn't he give up?"

Still Luka, if you take the time to write, some elaboration would be nice
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 12:48:06
 
Doitsujin

Posts: 5078
Joined: Apr. 10 2005
 

RE: Major major frustration (in reply to John O.

Hi John.
Im sorry, I have no time at the moment to write down the tientos falsetas... I have a bad day now. **** **** ****!!!! This ****ing ****!!! GGRRRAAAAH!!!
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 13:47:06
 
John O.

Posts: 1723
Joined: Dec. 16 2005
From: Seeheim-Jugenheim, Germany

RE: Major major frustration (in reply to Doitsujin

Hope it's not the car radio again

Don't worry about it. Tientos aren't till Tuesday anyways...
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 14:08:14
 
Doitsujin

Posts: 5078
Joined: Apr. 10 2005
 

RE: Major major frustration (in reply to John O.

No, the radio works fine. Just general crap which allways happen to me.

Tientos is on tuesday? All the classes where I play have holiday at the moment... Why is there class at your place? What kind of shool is it? Private?
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 14:26:38
 
cneberg

Posts: 257
Joined: Apr. 20 2006
From: Sončno polje pri Večnosti

RE: Major major frustration (in reply to John O.

quote:

Sorry, almost turned into a b*tchy baby there

I'm usually pretty confident about what I do, I just had a bad day when I made this thread and wanted to reassure myself that I'm not that guy in denial behind who's back everybody says "Geez, why doesn't he give up?"

Still Luka, if you take the time to write, some elaboration would be nice


Yep, you almost did. I read the edited post

Anyway, I try not to be hostile. I have bad experiences with forums. Actually I've been a member of a very few forums (maybe, two or three). But, as one guy here once said, I started to hate the person I've become on those boards. You know, ego is the biggest poison. I guess, because it's so complex and it's hard to get rid of it (almost imposible). But I think I ain't that bad character here (even if I only reply and don't upload my playing) I don't think I've said anything hostile on this board.

I completely understand your frustration, but this is something you've got to deal by yourself (ego). That's why I said, what I said. Who else are the people who know better how hard is to play flamenco, if not us, who struggle everyday to play the simplest falseta in compas.

About my playing.... I don't play flamenco, but I'm a huge fan of it and I respect those guys very much. I play in a small band, we play a bit of cuban music, some spanish rumbas,.... I play solo guitar, therefore I'm that villain, who mainly plays solos, picado scales, improvises mainly. Anyway, I have never ever in my life proclaimed myself as a flamenco guitarist, so my consious is clear.

I will upload my playing in the future, but it probably won't be flamenco. At least not in the near future, because I'm extremly self-critical, when it comes to flamenco.

Regards!
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 14:32:04
 
koella

Posts: 2194
Joined: Sep. 10 2005
From: holland

RE: Major major frustration (in reply to John O.

I don't get it John.

Why don't you just pick some nice pdl tientos falseta's ? Or sth. like that ?
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 14:33:46
 
John O.

Posts: 1723
Joined: Dec. 16 2005
From: Seeheim-Jugenheim, Germany

RE: Major major frustration (in reply to koella

I've found nothing up to now at 60 beats per minute which doesn't sound stupid, even the Paco Pena tiento from his "Toques" album is too fast to sound good at that speed. It's like a tiento at the speed of a slow solea...
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 14:53:15
 
John O.

Posts: 1723
Joined: Dec. 16 2005
From: Seeheim-Jugenheim, Germany

RE: Major major frustration (in reply to cneberg

I'd say my problem here is less my ego, more just wanting to make sure I'm not a complete joke. I've come to grips with the fact that I'm the least knowledgable and people will sometimes laugh at me or be negatively critical. I see this flamenco forum as a chance to get other independant opinions and discuss common frustrations. Also, I really DON'T know if I'm on the right track.

I don't know if English is your first language, but to me what you wrote was the same as writing "Shut up". That without any following is just rude to me, I'd have reacted the same way were it concerning anything else but guitar. Now I know you didn't mean it that way.

Gimme a hug
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 15:18:18
 
Doitsujin

Posts: 5078
Joined: Apr. 10 2005
 

RE: Major major frustration (in reply to John O.

I tested a 60bpm tiento with my metronom 60sec ago and ist rr ee a ll y s ll oooo ww..... I will tab you the emnrique de melchor tiento flaseta. Its also a bit stupid if you have to play it such slow. But you can add arpegios and strokes to fill it a bit. I think I played it in past too in a tiento danceclass. It works fine.
hmm I have to learn the alphabet of DNA equences and proteinsequences now... But tonight in front of the TV it isnt so boring as now..so I will tab it for you now. I hope you can use it!! Coz I have an exam on monday and cant concentrate at the moment.. I think I didnt learn anything in the last 3 days... DAMN!!
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 15:21:54
 
Doitsujin

Posts: 5078
Joined: Apr. 10 2005
 

RE: Major major frustration (in reply to John O.

John... SHUT UP!!








haha
It sounds like the same "flamenco-police" exist at your place as at my place. Dancers who think they know all about flamenco and all about how to play the guitar. If you arent their personal friend, you could play as Paco but they would tell other people that you are just a beginner and do many many mistakes.. eeeh.. I hate them. I hope these people didnt forced you to your first post here. Forget them.

P.S. I will learn the alphabets now and tab the tiento this evening.... I dont wanna fail..
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 15:28:03
 
John O.

Posts: 1723
Joined: Dec. 16 2005
From: Seeheim-Jugenheim, Germany

RE: Major major frustration (in reply to Doitsujin

See, you followed "Shut up" with something else - now that's okay
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 15:35:04
 
XXX

Posts: 4400
Joined: Apr. 14 2005
 

RE: Major major frustration (in reply to John O.

Which one is this here!:
AGCTTTCCCCTCCCAATTAATTAAGTTTAGCTCTTATCAGAGCGAGAGAGAGAGAGAGAG
AGGGAAGAAGAAGAAGTGGAAGTGGTATGTATGTGCCCATGTCCATTGCCGCAGAAACAA
ACTGTAGCAGCAGCAGCAGCAGCTAGTGAAGTACTACAGTACAGTAGTGAGGACTTAATC
AAACGGGGCGCGCGGGGTGCCCCCTAGCTCTCCTCATTCCACCACCATGCCCACCCCGCC
ATCGCCATGCCTCTTCTTCCTCTTCCTCCTCTTCTTCATGTGGTCGTCTCACTCTCACCT
TGGCGCCGCCTCCGACGCGGACGCGCTGCTCGCCCTCAAGTCCGCCCTCGACCGCTCCGA
CCGCCTCCCCTGGCGCCGCGACACCGCCCCCGCCTTGTGCTCCTCCTGGCTCGGCGTGCG
CCAGTGCTCCCAACCTCCCCGGGACAGGAGGGTCACCAAGCTCGTCCTCGAGAACCTCAA
CCTCACCGGCGTCCTCACCGCCACCCTCCTCGCCCCGCTCTCCGAGCTGCGCGTCCTCAG
CCTCAAGTCCAACGCCCTCACCGGCCCCATCCCCGACGCCCTCCCCGCCGCCCTCCCTAA
CCTCAAGCTGCTCTACCTCTCCGCCAACCGCCTCCAGGGCCGCATCCCGCCCACCCTCGC
CCTCCTCCACCGCGCCACCGTCCTCGTCCTCTCCTCCAACCTCCTCCATGGCGCTGAGGG
CCTACTTCCAGGCCAAGGAGGAGCGACTCCTCGTCTACGATTACTACCCCAATGGCAGCC
TCTTCTCCCTCCTCCACGGGTCCAGCAGCCGGACGTCGAGCAAGGGGAAGCCCCTGCACT
GGACGTCGTGCATGAAGATCGCGGAGGATGTCGCCGCCGGGCTGGTGCACCTGCACCAGT
CGCCGCCGGCTGGCATCGTGCACGGCAACCTCAAGCCCTCCAACGTCCTCCTCGGCCCCG
ACTTCGAATCGTGCCTCACCGATTACGGTCTGGTGCCCACGCTGCTCCCCTCCCACGCCG
ATCTCGCCTCCTCCACGTCCGTCCTATACCGAGCGCCGGAAACTCGCACCGCCCATGCCT
TCACGCCGGCGTCCGACGTGTACAGCTTCGGCGTGCTCCTCCTGGAGCTGCTCACCGGGA
AGGCGCCGTTCCAGGACCTGATGGAGATGCACAGCGATGACATCCCGAGCTGGGTGCGGG
CAGTGCGTGAGGAAGAGACGGAGTCCGGCGGGGAGTCCGCGTCCGCTGGCGGCACGGAGG
AGAAGCTCGGTGCGCTGATCAGCATTGCGGCGGCCTGCGTGGTGGCGGACCCGGCGAGGC
GGCCAACCACACCGGAGGTGCTACGGATGGTGAGGGAGGCAAGGGCGGAGGCAATGTCGT
CGTCGAACAGCAGCGACCGGTCACCAGCGCGGTGGTCAGACGCCGTGCAGGTGCAGATGG
GCATGGGGGTGCCGCGAGATCAGGGAGAGCTAGGAGGACTCACCTGATCGATCGATCAGC
AGCTGATCTCATCCTGATCAGCAGCTGATCATCGCCTGGCTGGCCGGCTTGTTGTTACTT
TACTTCATGTACCGTAGCAGCAAAAAAAGTGTAGTTACCACTCAATTTGTCTTGGCTCAA
AGAATGACTCATTCTTCAGGCAACACTTTTTAAATACCAGGGGTCTTTGATTTGGGACTT
GTGTAGGTTTTTAGCAGGGAAGGGTGGGGCATTGGGAGATACTCCTAGCTTAGATAGGTT
CAGAGATGAAGATTCTCTGGGCTGGATCTGTCTGTAAATCTTTTTTGGATTGTTGTAAAC
TTGTCCTTTTTATTTTTTCCGGAGTGGAGCTAAACTGGTTTATGTGTCAAAAA

Hehe, sorry just kidding!

_____________________________

Фламенко
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 15:42:42
 
John O.

Posts: 1723
Joined: Dec. 16 2005
From: Seeheim-Jugenheim, Germany

RE: Major major frustration (in reply to XXX

The genetic code of pudding
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 15:48:49
 
Doitsujin

Posts: 5078
Joined: Apr. 10 2005
 

RE: Major major frustration (in reply to John O.

At first, very very sorry for this off Topic!!
-------------------------------------------------------------------------------------------------------
Start OFF TOPIC:
But I was forced to do it.. Its like you throw a wood..the dog cant resist..it HAS to bring it back. So I study this mess,.. I cant resist to find the origin of Deniz DNA-Sequence.... sorry..But Im helpless....
By the way the DNA alphabet has more than ATG and C It has a minimum of 15 letters maybe some more which I dont know at the moment.

Ok Deniz you wanted it you get it..hehe ^^
I searched it with BLAST//-Genbank which is in the USA. But EMBL from England and DDBJ from Japan would give the same results.
If you can tell me why they would give me exact the same results, I will pay for one packet of strings for you. (^_-) But the answere is not: Coz the sequence is the same.
I found a full match in the cDNA clone of Oryza sativa. (=CDNA clone:J033028O18, full insert sequence Oryza sativa, 49 sequence(s))

Its nearely 100% shure that its from the genome of the Oryza sativa (japonica cultivar-group)
The more common name is Japanese rice!!
Hey where did you get this sequence?? Is that a joke with the japanese rice coz of my name?? WUHAHA ^^ Thats cool Deniz!!
With 60% its from a chromosome maybe the 18th of Mus musculus. But I dont think so.
But nothing is 100% shure in biology-science..so it could be wrong. But I think Im right..hmmm


Here is a picture and some details of the rice:




Here I show you the searchresult:

GenBank
LOCUS AK101172 1857 bp mRNA linear PLN 24-JUL-2003
DEFINITION Oryza sativa (japonica cultivar-group) cDNA clone:J033028O18, full
insert sequence.
ACCESSION AK101172
VERSION AK101172.1 GI:32986381
KEYWORDS FLI_CDNA; CAP trapper.
SOURCE Oryza sativa (japonica cultivar-group)
ORGANISM Oryza sativa (japonica cultivar-group)
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
REFERENCE 1
AUTHORS The Rice Full-Length cDNA Consortium, National Institute of
Agrobiological Sciences Rice Full-Length cDNA Project Team:,
Kikuchi,S., Satoh,K., Nagata,T., Kawagashira,N., Doi,K.,
Kishimoto,N., Yazaki,J., Ishikawa,M., Yamada,H., Ooka,H., Hotta,I.,
Kojima,K., Namiki,T., Ohneda,E., Yahagi,W., Suzuki,K., Li,C.,
Ohtsuki,K., Shishiki,T., Foundation of Advancement of International
Science Genome Sequencing & Analysis Group:, Otomo,Y., Murakami,K.,
Iida,Y., Sugano,S., Fujimura,T., Suzuki,Y., Tsunoda,Y.,
Kurosaki,T., Kodama,T., Masuda,H., Kobayashi,M., Xie,Q., Lu,M.,
Narikawa,R., Sugiyama,A., Mizuno,K., Yokomizo,S., Niikura,J.,
Ikeda,R., Ishibiki,J., Kawamata,M., Yoshimura,A., Miura,J.,
Kusumegi,T., Oka,M., Ryu,R., Ueda,M., Matsubara,K., RIKEN:,
Kawai,J., Carninci,P., Adachi,J., Aizawa,K., Arakawa,T., Fukuda,S.,
Hara,A., Hashidume,W., Hayatsu,N., Imotani,K., Ishii,Y., Itoh,M.,
Kagawa,I., Kondo,S., Konno,H., Miyazaki,A., Osato,N., Ota,Y.,
Saito,R., Sasaki,D., Sato,K., Shibata,K., Shinagawa,A., Shiraki,T.,
Yoshino,M. and Hayashizaki,Y.
TITLE Collection, mapping, and annotation of over 28,000 cDNA clones from
japonica rice
JOURNAL Science 301 (5631), 376-379 (2003)
PUBMED 12869764
REFERENCE 2 (bases 1 to 1857)
AUTHORS Adachi,J., Aizawa,K., Akimura,T., Arakawa,T., Carninci,P., Doi,K.,
Fujimura,T., Fukuda,S., Hanagaki,T., Hara,A., Hashizume,W.,
Hayashida,K., Hayashizaki,Y., Hayatsu,N., Hiramoto,K., Hiraoka,T.,
Hori,F., Hotta,I., Iida,J., Iida,Y., Ikeda,R., Imamura,K.,
Imotani,K., Ishibiki,J., Ishii,Y., Ishikawa,M., Itoh,M., Kagawa,I.,
Kanagawa,S., Katoh,H., Kawagashira,N., Kawai,J., Kawamata,M.,
Kikuchi,S., Kishikawa-Hirozane,T., Kishimoto,N., Kobayashi,M.,
Kodama,T., Kojima,K., Kojima,Y., Kondo,S., Konno,H., Kouda,M.,
Koya,S., Kurihara,C., Kurosaki,T., Kusumegi,T., Li,C., Lu,M.,
Masuda,H., Matsubara,K., Matsuyama,T., Miura,J., Miyazaki,A.,
Mizuno,K., Murakami,K., Murata,M., Nagata,T., Nakamura,M.,
Namiki,T., Narikawa,R., Niikura,J., Nishi,K., Nomura,K.,
Numasaki,R., Ohneda,E., Ohno,M., Ohtsuki,K., Oka,M., Ooka,H.,
Osato,N., Ota,Y., Otomo,Y., Ryu,R., Saitoh,H., Sakai,C., Sakai,K.,
Sakazume,N., Sano,H., Sasaki,D., Sato,K., Satoh,K., Shibata,K.,
Shinagawa,A., Shiraki,T., Shishiki,T., Sogabe,Y., Sugano,S.,
Sugiyama,A., Suzuki,K., Suzuki,Y., Tagami,M., Tagami-Takeda,Y.,
Tagawa,A., Takahashi,F., Takaku-Akahira,S., Tanaka,T., Tomaru,A.,
Toya,T., Tsunoda,Y., Ueda,M., Waki,K., Xie,Q., Yahagi,W.,
Yamada,H., Yamamoto,M., Yasunishi,A., Yazaki,J., Yokomizo,S. and
Yoshimura,A.
TITLE Direct Submission
JOURNAL Submitted (27-AUG-2002) Shoshi Kikuchi, National Institute of
Agrobiological Sciences, Department of Molecular Genetics, Head of
Laboratory of Gene Expression; 2-1-2 Kannondai, Tsukuba, Ibaraki
305-8602, Japan (E-mail:skikuchi@nias.affrc.go.jp,
Tel:81-29-838-7007, Fax:81-29-838-7007)
COMMENT This clone is one of the 28K full-length cDNA clones from japonica
rice.
URL : http://cdna01.dna.affrc.go.jp/cDNA/
NIAS Rice Full-Length cDNA Project Team: Kikuchi,S., Satoh,K.,
Nagata,T., Kawagashira,N., Doi,K., Kishimoto,N., Yazaki,J.,
Ishikawa,M., Yamada,H., Ooka,H., Hotta,I., Kojima,K., Namiki,T.,
Ohneda,E., Yahagi,W., Suzuki,K., Li,C., Ohtsuki,K., Shishiki,T. and
Yamamoto,M.
FAIS Genome Sequencing & Analysis Group: Otomo,Y., Iida,Y.,
Fujimura,T., Ikeda,R., Ishibiki,J., Kawamata,M., Kobayashi,M.,
Kodama,T., Kurosaki,T., Kusumegi,T., Lu,M., Masuda,H., Miura,J.,
Mizuno,K., Narikawa,R., Niikura,J., Oka,M., Ryu,R., Sugano,S.,
Sugiyama,A., Suzuki,Y., Tsunoda,Y., Ueda,M., Xie,Q., Yokomizo,S.,
Yoshimura,A., Matsubara,K. and Murakami,K.
Genome Exploration Research Group in Riken Genomic Sciences Center
and Genome Science Laboratory in Riken: Adachi,J., Aizawa,K.,
Akimura,T., Arakawa,T., Carninci,P., Fukuda,S., Hanagaki,T.,
Hara,A., Hashizume,W., Hayashida,K., Hayatsu,N., Hiramoto,K.,
Hiraoka,T., Hori,F., Iida,J., Imamura,K., Imotani,K., Ishii,Y.,
Itoh,M., Kagawa,I., Kanagawa,S., Katoh,H., Kawai,J.,
Kishikawa-Hirozane,T., Kojima,Y., Kondo,S., Konno,H., Kouda,M.,
Koya,S., Kurihara,C., Matsuyama,T., Miyazaki,A., Murata,M.,
Nakamura,M., Nishi,K., Nomura,K., Numasaki,R., Ohno,M., Osato,N.,
Ota,Y., Saitoh,H., Sakai,C., Sakai,K., Sakazume,N., Sano,H.,
Sasaki,D., Sato,K., Shibata,K., Shinagawa,A., Shiraki,T.,
Sogabe,Y., Tagami,M., Tagami-Takeda,Y., Tagawa,A., Takahashi,F.,
Takaku-Akahira,S., Tanaka,T., Tomaru,A., Toya,T., Waki,K.,
Yasunishi,A. and Hayashizaki,Y.
FEATURES Location/Qualifiers
source 1..1857
/organism="Oryza sativa (japonica cultivar-group)"
/mol_type="mRNA"
/cultivar="Nipponbare"
/db_xref="taxon:39947"
/clone="J033028O18"
ORIGIN
1 ggttagtta-->a gctttcccct cccaattaat taagtttagc tcttatcaga gcgagagaga
61 gagagagaga gggaagaaga agaagtggaa gtggtatgta tgtgcccatg tccattgccg
121 cagaaacaaa ctgtagcagc agcagcagca gctagtgaag tactacagta cagtagtgag
181 gacttaatca aacggggcgc gcggggtgcc ccctagctct cctcattcca ccaccatgcc
241 caccccgcca tcgccatgcc tcttcttcct cttcctcctc ttcttcatgt ggtcgtctca
301 ctctcacctt ggcgccgcct ccgacgcgga cgcgctgctc gccctcaagt ccgccctcga
361 ccgctccgac cgcctcccct ggcgccgcga caccgccccc gccttgtgct cctcctggct
421 cggcgtgcgc cagtgctccc aacctccccg ggacaggagg gtcaccaagc tcgtcctcga
481 gaacctcaac ctcaccggcg tcctcaccgc caccctcctc gccccgctct ccgagctgcg
541 cgtcctcagc ctcaagtcca acgccctcac cggccccatc cccgacgccc tccccgccgc
601 cctccctaac ctcaagctgc tctacctctc cgccaaccgc ctccagggcc gcatcccgcc
661 caccctcgcc ctcctccacc gcgccaccgt cctcgtcctc tcctccaacc tcctccatgg
721 cgctgagggc ctacttccag gccaaggagg agcgactcct cgtctacgat tactacccca
781 atggcagcct cttctccctc ctccacgggt ccagcagccg gacgtcgagc aaggggaagc
841 ccctgcactg gacgtcgtgc atgaagatcg cggaggatgt cgccgccggg ctggtgcacc
901 tgcaccagtc gccgccggct ggcatcgtgc acggcaacct caagccctcc aacgtcctcc
961 tcggccccga cttcgaatcg tgcctcaccg attacggtct ggtgcccacg ctgctcccct
1021 cccacgccga tctcgcctcc tccacgtccg tcctataccg agcgccggaa actcgcaccg
1081 cccatgcctt cacgccggcg tccgacgtgt acagcttcgg cgtgctcctc ctggagctgc
1141 tcaccgggaa ggcgccgttc caggacctga tggagatgca cagcgatgac atcccgagct
1201 gggtgcgggc agtgcgtgag gaagagacgg agtccggcgg ggagtccgcg tccgctggcg
1261 gcacggagga gaagctcggt gcgctgatca gcattgcggc ggcctgcgtg gtggcggacc
1321 cggcgaggcg gccaaccaca ccggaggtgc tacggatggt gagggaggca agggcggagg
1381 caatgtcgtc gtcgaacagc agcgaccggt caccagcgcg gtggtcagac gccgtgcagg
1441 tgcagatggg catgggggtg ccgcgagatc agggagagct aggaggactc acctgatcga
1501 tcgatcagca gctgatctca tcctgatcag cagctgatca tcgcctggct ggccggcttg
1561 ttgttacttt acttcatgta ccgtagcagc aaaaaaagtg tagttaccac tcaatttgtc
1621 ttggctcaaa gaatgactca ttcttcaggc aacacttttt aaataccagg ggtctttgat
1681 ttgggacttg tgtaggtttt tagcagggaa gggtggggca ttgggagata ctcctagctt
1741 agataggttc agagatgaag attctctggg ctggatctgt ctgtaaatct tttttggatt
1801 gttgtaaact tgtccttttt attttttccg gagtggagct aaactggttt atgtgtc
------------------------------------------------------------------------------------------------------
Above is the mached sequence. But listen, its not a 100% identical match. Coz of that there are some tiny mismatches like the end.. But to 1561 are the main matches.
------------------------------------------------------------------------------------------------------

Here some screenshots from the results to proove it. (Only the link, not the pic, coz we talk about flamenco here..it would be too much I think)
http://img172.imageshack.us/img172/2544/blast45tt.jpg
http://img172.imageshack.us/img172/8468/blast21mw.jpg
http://img172.imageshack.us/img172/5030/blast38cf.jpg

By the way,..many scientists made a collection (Collection, mapping, and annotation of over 28,000 cDNA clones from japonica rice.) It was published in Science. 2004 Jan 9;303(5655):168; author reply 168.
You can get it here Deniz. (^_-)
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=12869764

Any more sequence questions??
Off Topic end.
--------------------------------------------------------------------------------------------------------

Images are resized automatically to a maximum width of 800px
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 17:29:51
 
Ricardo

Posts: 14887
Joined: Dec. 14 2004
From: Washington DC

RE: Major major frustration (in reply to Doitsujin

Pretty close. Actually, I think is part of a code for a monkey with 5 butts, but that is just at a glance.

John, don't get down about it man. You don't have to be a dance accompanist to be a good flamenco. Moraito hates accompanying dance, he does not like the structure of it or having no room to improvise. Great flamenco master guitarists are sometimes called "solista" as if it is a bad thing to play good solos pieces or compose. There are those that focus only on cante accomp. It is good to be well versed in all that is flamenco, but those that specialize in dance accompaniment are really dedicated to that mainly. They are not necessarily good composers or even have that special senisativity for cante accompaniment. But that is OK too. Sometimes you come across someone great at it all. So don't force yourself to please EVERY dancer or whatever, it is not so important. It is hard to find what they need exactly, and what they don't really need. That is why it takes experience. Rarely do you find a dancer who says "can you play Reflejo de la Luna, I want to dance to that". But they actually are around. Understand they are not musicians, so comunicating with them can be difficult.

Anyway, for tientos 60 bpm, think about arpeggios. Pick 4 chords you like, ending on A of course, and do 16th note arpegio, then sextuplets on each chord. A bit of swing on the 16ths gives the feel of tientos. Does not matter the arp. pattern, only the rhythm and phrasing matters. Check out Chicuelo's vid of solea for baile. Super slow arpeggios keeps things pretty and moving. Same idea applies to any super slow dance.

I had to do Solea at like 40 bpm. It was like BRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR,THREE............. BRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR,SIX etc. Painful.

Ricardo
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 19:24:14
 
XXX

Posts: 4400
Joined: Apr. 14 2005
 

RE: Major major frustration (in reply to John O.

This is supposed to be a monkey...but only with 4 asses!



Sorry John! This is one of the most funny topics ever. Doit, hm good work, although they dont match 100%, but im far away from understanding anything... hmmm, actually im thinking of typing another acgtactgc into google
i would be really interested in the code of a 5-assed monkey... maybe you just copy&paste the "ass section" 5 times???!!!

Images are resized automatically to a maximum width of 800px

_____________________________

Фламенко
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 20:00:56
 
Ron.M

Posts: 7051
Joined: Jul. 7 2003
From: Scotland

RE: Major major frustration (in reply to John O.

quote:

Hey guys. Gotta vent here.

I suck at flamenco. I mean, really.

Ask me to play "Reflejo de Luna", "Con Garbo y Salero", "a really cool intro I heard once from Vicente", no problem.

Sit me in a class and ask me to accompany, all you'll get is chord strumming. Lots of syncopation, mind you, yet still the most uninspirational crap you'll ever hear. Ask me to play a falsetta, "Duuuh, I dunno", more chords.

A lot of it could be nervousness, somehow I just can't put the technique I have together with the dance accompanyment, though I've been accompanying quite intensly for about two years now.

Should I just give up?????


Wow!
This thread has really got out of perspective!
Should you give up?
Well...the answer is simply no...
What are you comparing yourself to?
PdL, Tomatito, Vincente, Gerardo?
These guys are at the top of the Flamenco tree..
They've lived the life, done the stuff, while we were all playing "Space Invaders" to try to detract from boring school lessons... (not me..before my time.. )

So you've discovered Flamenco at a later age than you would have liked to?
Technique not so good as younger Spanish hot shots?

If you want to be really sincere to yourself...there are probably dozens of minor Flamenco players in Spain who could play you under the table, technique-wise and knowledge-wise.

You've just got to accept that!!

You've got to ask yourself the question of...
Do I really want to know more and more about Flamenco and do the best I can and be sincere to myself?
Or..
Do I want to be a hotshot kid that everybody is impressed by and praises and everybody thinks is wonderful and you can walk off stage with your nose in the air after impressing everyone?

Music is music..technique is technique...

If you want to impress folk then get into Formula One Racing...and be great at it!
Spray the Champagne into the crowd and enjoy your success...

There are a lot easier ways of impressing folk other than playing Flamenco Guitar.

But if you enjoy just the sound and slowly trying to improve...just for the hell of it...

Then it's a lifelong companion!

When playing ceases to be fun and a personal challenge then, personally.. I'd say...quit....it's doing you no good at all.
There are dozens of things out there you could make a success at....

Unless you're addicted..


cheers

Ron
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 20:30:53
 
Doitsujin

Posts: 5078
Joined: Apr. 10 2005
 

RE: Major major frustration (in reply to John O.

Yes Ricardo, I never thought about that. No I have a new point of view with the acompanimento thing. Thanks! I allways took it tooo serious to play for dance. But maybe coz of that I have a great flexible grooving bulerias compas. More in the direction to Tomatito than Moraito, coz I dont like Moraitos stuff very much.

quote:

Technique not so good as younger Spanish hot shots?.......there are probably dozens of minor Flamenco players in Spain who could play you under the table, technique-wise and knowledge-wise.

In general Im with Rons opinion, but not complete with this one above. Im not against Ron but against the point in general. And I heared it often.
I dont like it to say "spanish" hot shots. Hey I know german players who play dozens of the best spanish joug hotshots in spain under the table. Not all are so good. Yes there are most of the best, coz flamenco is mainly a spanish thing. But John doesnt have to fright the hotshots over there. He also can play many of them under the table. With the knowledge.. I think I dont have to know all the details of cante, dance and guitar to become a good player and maybe better than many who have this knowlege. There are over hundred different fandangos de huelvas..Who cares. The journal-writers and many people around the world, especially the spanish allways give the flamenco to much blablabla... Its not so complicated as they all say. As I told in past, if you are born in spain. Maybe just in a plane which flew above spain during the birth...and the people hear that you are from spain.. They all think that you know flamenco...pfffff....
Sorry, but I dont like always hear that flamenco is just a spanish thing. Its not. And if so many people would do flamenco here as there, there would be as many as advanced players in my country as in spain. But this music isnt popular enough here. As rugby or Sumo or tree widethrow or running over glowing ash.

hhuuuh.. sorry I had to tell that..

A monkey with 4 asses??? HAahaha... I will test that!!
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 20:38:35
 
Ron.M

Posts: 7051
Joined: Jul. 7 2003
From: Scotland

RE: Major major frustration (in reply to Doitsujin

quote:

Sorry, but I dont like always hear that flamenco is just a spanish thing.


I don't either Doit...

But you gotta admit ...it's a pretty good start!..

Anyway I've heard a lot of Spanish players who are totally uninspiring...

So don't give up!!

cheers

Ron

(Remember...Amir Haddad was born in Germany from Palestinian-Columbian parents...yet he is an incredible Flamenco player...get his Album!)
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 21:05:02
 
duende

Posts: 3053
Joined: Dec. 15 2003
From: Sweden

RE: Major major frustration (in reply to Ron.M

his album is realy good.
I get huge Pdl vibes from it.

_____________________________

This is hard stuff!
Don't give up...
And don't make it a race.
Enjoy the ray of sunshine that comes with every new step in knowledge.

RON
  REPORT THIS POST AS INAPPROPRIATE |  Date Jul. 6 2006 21:20:08
Page:   [1] 2    >   >>
All Forums >>Discussions >>General >> Page: [1] 2    >   >>
Jump to:

New Messages No New Messages
Hot Topic w/ New Messages Hot Topic w/o New Messages
Locked w/ New Messages Locked w/o New Messages
 Post New Thread
 Reply to Message
 Post New Poll
 Submit Vote
 Delete My Own Post
 Delete My Own Thread
 Rate Posts


Forum Software powered by ASP Playground Advanced Edition 2.0.5
Copyright © 2000 - 2003 ASPPlayground.NET

0.125 secs.